castanyes blaves

2008 alcohol consumption in Europe (litres per head)

* Czech Republic - 12.3
* Austria - 10.4
* Lithuania - 10.1
* Germany - 10.0
* Spain/Hungary - 9.8
* Portugal/Slovakia/Denmark - 9.3
* Poland - 9.8
* Belgium/Luxembourg - 8.5
* UK - 8.4
* Finland/Greece - 7.6

Source: BBPA Statistical Handbook 2010

Euphemisms called “labs” coexist in structured universal aggregations where they compete with one another for scarce resources. Labs cooperate to produce copious numbers of zygotes, most of which disperse synchronously each year. The strongest find their way into the protective brood pouches of crusty adults who shed soft-shelled offspring at regular intervals (slowly developing zygotes die by the incompletely understood process of academic apoptosis). Juveniles develop a hard external carapace by intermittently joining and extracting themselves from other labs. The hardened but vulnerable sub-adults then join a common pool where they compete for space and position on rapidly eroding substrate in the universal aggregation. Many become dormant and fail to contribute to the gene (meme) pool. Some return to the lab as brood-rearing helpers. Few survive the rampant competition and frenzied cannibalism in the pool. Not all of the survivors are safe on the fragile substrate. A second apoptosis-like event eliminates the weak and meek. Only the most persistent or aggressive remain.

These are the highlights:

1) All bonuses over £2,500 would be payable in shares, which couldn't be redeemed, or pledged as security for loans or turned into anything spendable for at least five years.

2) No one on the board of a bank, not even the chief executive, would be eligible for a penny of bonus.

3) Loss-making banks would be banned from paying bonuses.

4) Every employee of a bank earning more than the prime minister - which Mr Clegg defines as circa £200,000 - would be publicly named.

IDEA 12: Phylogenetic Tree plugin ¶

Most of the software for visualization of phylogenetic tree is command line driven. Cytoscape's enhanced graphical abilities can be used to layout a phylogenetic tree, zoom a region, assign colors to groups of nodes and edges, generates publication-quality images. A Cytoscape plugin (PhyloTreePlugin) could become very useful tool for scientists studying phylogenetic trees. A student (GSoC 2009) already implemented some algorithms to visualize the rooted trees, this year we want to extend the plugin to support the visualization of un-rooted tree to make the plugin complete. The task includes the support of more format of phylogenetic tree and implements more algorithms for visualization of phylogenetic tree.

Language and skills: Java

Idea by: Peng Liang Wang

Potential Mentors: Peng Liang Wang, Scooter Morris, sign up here

Phylomovies: interactive animations of gene tree evolution

This project would produce a tool useful for both science and outreach, and which could ultimately become linked with the Ensembl database and be used by thousands of biologists worldwide every day.

Rationale
Evolving DNA is usually represented by static pictures, like trees, that are sometimes difficult to decipher. A movie is a more natural medium for presenting the evolutionary processes that shape the genomes of all living species. Comparative genomics databases such as Ensembl, Pfam, and HomoloGene use large amounts of data and powerful inference methods to construct highly-resolved evolutionary histories of individual gene families, including the characteristic patterns of duplication and speciation leading to the gene content observed today. However, the static nature of image-based visualizations can make the interpretation of such "gene family trees" a bit difficult.

In the same way that the Google-acquired Trendalyzer technology uses animation to clarify and expose trends in economic data, an evolutionary movie would help scientists and the public better understand the meaning and importance of evolutionary data.
Approach
The goal of this project would be to create an online widget that loads gene tree data in standard formats (XML / NHX format trees) and generates an interactive movie, allowing users to temporally navigate through the evolution of a given gene family. This would involve the design, implementation and exhibition of a novel visualization interface.

In terms of implementation, one option would be to use the PhyloWidget codebase as a starting point, although other options (such as Flash) should be considered, depending on the student's expertise. A mock-up animation of the evolution of the Tropomyosin gene can be found here. Animations relating a gene tree can also be found here [1].

Possible extensions to the tool would include the incorporation / correlation of species tree information and divergence time estimates, and exporting animations to non-interactive movie formats.
Challenges

* (medium) Identify the most appropriate libraries and tools to work with
* (hard) Define and implement a system for converting static phylogenetic trees (and associated metadata) into animations
* (medium-to-hard) Create an interface for visualizing / exploring / exporting the animations

Involved toolkits or projects

* Possible languages: Java, Flash, Javascript
* Possible toolkits / libraries: PhyloWidget, Archaeopteryx, ScripTree

Degree of difficulty and needed skills
Medium. Will require creative thinking, interface design, and solid background in a client-side browser language (Java, JavaScript or Flash).
Other topics
Any alternative proposals aimed towards improving the "accessibility" of phylogenetic trees to non-specialist audiences are encouraged. Also, alternative proposals would include implementing new methods for visualizing biological data on trees: e.g., bootstrap values / tree uncertainty, population size estimates, or uncertainty in divergence times.
Mentors
Gregory Jordan (PhyloWidget), Albert Vilella (Ensembl Compara)

Google maps-like multi-genome browsing in Jalview

Rationale
The amount of genomic data is increasing exponentially since the advent of the next generation sequencing techniques. New visualizations tools are needed to be able to compare genomic data at multiple resolutions in a natural way. One way to do this would be to adopt user interaction principles from successful multi-resolution interfaces, such as Google Maps.
Approach
Most problems with Jalview's interface become obvious when working with large alignments. An initial examination of the UI issues should first be made, and some solutions proposed to improve the user's experience when working with large alignments (and trees). These solutions should then be prototyped using a snapshot of the current Jalview 2.X codebase so their effectiveness can be assessed by expert users.
Challenges

* (easy/medium) adapting Jalview's existing multi-window visualizations implemented in AWT and Swing
* (hard) efficient multiscale rendering of very large multiple sequence alignments
* (medium/hard) solving the memory and rendering issues that arise when interactively visualizing and editing very large alignments.

Degree of difficulty and needed skills
Medium to hard. Java. Experience with either or both AWT and Swing. Some familiarity with low level file handling, or alternately, experience with handling datasets with many thousands of sequences (e.g. with Picard).
Other Topics
There are plenty of other areas to work on in Jalview - topics include AJAX and DAS (extending the JalviewLite for working with DAS annotation servers), Phylogenetic visualization (wider tree format support and better interactive visualization) and extending support for RNA (linked secondary structure visualization, alignment and analysis services). Please contact the Mentors for further information.
Mentors
Jim Procter and Albert Vilella

Cooking is something we all take for granted but a new theory suggests that if we had not learned to cook food, not only would we still look like chimps but, like them, we would also be compelled to spend most of the day chewing.

OECD Government debt as % of GDP

As Europe is roiled by sovereign debt fears, it’s important to realize that the crisis in the largest of the PIIGS (Portugal, Ireland, Italy, Greece, Spain) has nothing to do with fiscal irresponsibility. On the even of the crisis, Spain was running a budget surplus; its debts, as you can see in the figure above, were low relative to GDP.

So what happened? Spain is an object lesson in the problems of having monetary union without fiscal and labor market integration. First, there was a huge boom in Spain, largely driven by a housing bubble — and financed by capital outflows from Germany. This boom pulled up Spanish wages. Then the bubble burst, leaving Spanish labor overpriced relative to Germany and France, and precipitating a surge in unemployment. It also led to large Spanish budget deficits, mainly because of collapsing revenue but also due to efforts to limit the rise in unemployment.

If Spain had its own currency, this would be a good time to devalue; but it doesn’t.

On the other hand, if Spain were like Florida, its problems wouldn’t be as severe. The budget deficit wouldn’t be as large, because social insurance payments would be coming from Brussels, just as Social Security and Medicare come from Washington. And there would be a safety valve for unemployment, as many workers would migrate to regions with better prospects. (Wages wouldn’t have gone up as much in the first place, because of in-migration).

The point is that this has nothing to do with a spendthrift government; what’s happening to Spain reflects the inherent problems with the euro, which now more than ever looks like a monetary union too far.

To be clear, there is no direct read-across (to use the dreadful business cliche) from Greece's acute difficulties in borrowing: the UK's finances are in better shape than Greece's, the UK economy is more flexible than Greece's and there isn't international pressure on the UK to improve the accuracy and reliability of government book-keeping.

Idiom
12. pull someone's chestnuts out of the fire, to rescue someone from a difficulty.

PD: I want one!

I realized, after the last post, that it might be useful to write down just what the Econ 101 version of cap and trade looks like; as it happens, this also helps explain the intellectual sins of Glenn Beck and Martin Feldstein.

So here we go. Bear in mind that something like what follows can be found in just about every intro textbook.

Think of the benefits to the private sector from pollution. Yes, benefits — in the sense that it’s cheaper to pollute than not to, or that it’s easier to produce goods if you don’t worry about whatever emissions result as a byproduct. So we can think of drawing a curve representing the private marginal benefit of emissions, as in this figure:

In the absence of government action, the private sector will increase emissions up to the point where there is no further marginal benefit. That is, emissions will rise to whatever level is implied by profit-maximization, paying no attention to the effects on the environment.

A cap-and-trade system puts a limit on overall emissions, so that emitters have to pay a price for emitting. This price will, as shown in the figure above, equal the marginal benefit of the last unit of emissions allowed.

Now, the cost to the economy of this limit is the benefit the private sector would have gotten by emitting more than is allowed under the cap. It’s shown in the figure as the red triangle labeled “deadweight loss”. CBO puts these losses under Waxman-Markey at 0.2-0.7 percent of GDP in 2020, 1.1 to 3.4 percent in 2050. These costs have to be set against the environmental benefits.

In addition to this overall economic cost, there’s a distributional effect. The creation of cap and trade means that emission permits command a market price, and the value of these permits — the blue rectangle — goes to someone. Under Waxman-Markey, some of it (a growing fraction over time) would be captured by the government through auctions, and used to cut or avoid increases in other taxes — in effect, recycled to consumers. The rest would be passed on to industry — but because the biggest recipients would be regulated utilities, much of this would also be passed on to consumers.

OK, now let’s send in Beck and Feldstein.

Beck got his number from someone who learned about a guesstimate of what the auction value of permits might be (way higher than current estimates, by the way), divided by the number of households, and proclaimed this the cost of the bill. In effect, he looked at a guess about the size of the blue rectangle, which does not represent an economic cost, and called that the cost to the economy.

In a way, though, what Martin Feldstein did was worse. He took the CBO’s estimate of “compliance costs”, which was $1600 per household in an early report (it’s now down to $900, but who’s counting?), and implied that this was the economic cost of the legislation. But “compliance costs” are basically the sum of the blue rectangle and the red triangle; the true economic costs are just the triangle, and are much smaller.

Another way to say this is that under the Feldstein method, any time you try to correct an externality, which necessarily means changing relative prices, all of the negative effects of the price change will be counted as a cost — but none of the positive effects will be counted as a benefit.

Bad stuff. And what you should bear in mind is that all I’m doing here is conventional neoclassical economics, quite literally basic textbook material. What does it say when the people who claim to believe in this stuff throw it out the window as soon as it leads to policy conclusions they don’t like?

Caption Competition
12. At 12:31pm on 06 Aug 2009, LaurenceLane wrote:

The PGA have been urged to rule on the use of polyurethane suits by spectators, even if rain has been forecast.

12:00 UK time, Thursday, 6 August 2009

The skills necessary within the Facility include the following.

1.

An intimate knowledge of UNIX-based operating systems.
2.

Understanding of a scripting language such as Perl.
3.

An understanding of parallel computing environments for UNIX clusters.
4.

Knowledge of network-based data storage.
5.

General knowledge of biology and genome sciences.
6.

Ability to derive data analysis and software requirements from investigators who do not have a sophisticated understanding of information technology.
7.

Ability to develop software encapsulating new analysis methods.
8.

Understanding of relational databases and database architecture.
9.

Ability to seek out and test novel bioinformatics software and analysis routines.

Amemiya and his co-workers became suspicious that the lamprey's genome structure and composition was changing during development when they heard rumors lamprey genome sequences efforts were being complicated by genome fragmentation. They speculated that this might be due to genome rearrangements similar to those described for the hagfish, a chordate and superficially similar organism.

To test this, the researchers compared germ line and somatic tissues from sea lamprey caught in Lake Michigan.

Indeed, they found that the genome was larger in sperm (germ line cells) than in adult blood nuclei (somatic cells), even within the same individual. The sperm cells also contained more DNA than kidney and liver cells, which both had similar DNA content to red blood cells. Overall, the researchers noted, sperm genomes contained some 20 percent more DNA than adult cells such as red blood cells.

Over the last several years, genome-wide association studies have become the primary method for identifying variations associated with human disease, but the approach has shortcomings that are leading some in the genomics community to push more aggressively into the post-GWAS era.

At Cambridge Healthtech Institute's Genomic Tools and Technologies Summit held here this week, many speakers noted that even though GWA studies have linked hundreds of common SNPs to disease, these variants account for only a very small portion of disease heritability, which has raised doubts over their clinical value. A number of talks focused on two key alternatives to GWAS: the discovery of rare variants, as opposed to common variants, with a role in disease; and an increasing focus on copy number variants rather than SNPs.

"GWAS was never meant to substitute for fine genomic sequencing," but rather to identify regions of linkage disequilibrium in the genome that warrant further study

Lupski said that efforts like the 1000 Genomes Project will likely produce valuable information that will drive improvements in the use of sequencing for CNV detection. "It's coming along," he said. "I think this will be solved."

• New interesting cDNAs that don't have hits against existing public cDNAs -- What do they do?
  
• Expression patterns -- Are these different to the patterns in other close species?
  
• Protein coding evolution -- run pairwise dNdS against closest genome or tree-based dNdS against an existing phylogeny [1,2] -- Does anything show up in a Gene Ontology enrichment analysis?

• Very few anolis proteins and cDNAs, many more ESTs.
• Used Uniprot PE Evidence ranking to generate transcript models with genewise
• Different parameters for Exonerate, including exhaustive option for cDNAs, including 31000 chicken set (which wasn't very useful in the end)
• Chris Ponting group provided extra models and kill list to rename some retrotransposons and pseudogenes
• Manually looked at some of the EST genes in Chris' list to reincorporate them in the main db

• Transcriptome coverage is hugely biased to the 3' end (or 5' depending on library preparation). A lot more than I suspected.
• Would be great to do queries for phylogenetic subclades: e.g. my human sequence against all SRA data for primates.
• A lot of the 454 data has homopolymer issues, mostly TTT[...]TTTs but also some others:
  

Query  465  GGGCCTTGACAAAGTGTAAACCGCATGGATGGGCTTCCCC-AAGGATTTATTGACATTGC  523<br /><font color="#ff0000"><b>Sbjct</b></font>  249  ........................................<font color="#ff0000"><b>C</b></font>...................  190<br /><br /></pre><ul><li>Some of these (unless they are real variations) get picked up as mismatches, some as indels:<pre>Query  1    CGGCAAGGTATGTGCGTGATTTTGGGCCCACGTGTATTTCCATTAATTTT-AAGCCGTAA  59<br /><font color="#ff0000"><b>Sbjct</b></font>  224  ..................................................<font color="#ff0000"><b>T</b></font>.........  165<br /><br />Query  60   TTGTCGTTTTTGGCGGTTTCGAGTTGAACTGCGTTAGTCCGTGCGCTGTTCGCAAGTGTG  119<br /><font color="#ff0000"><b>Sbjct</b></font>  164  ..........<font color="#ff0000"><b>C</b></font>.................................................  105<br /></pre></li></ul><pre><br />Query  61   TGTCGTTTTTGGCGGTTTCGAGTTGAACTGCGTTAGTCCGTGCGCTGTTCGCAAGTGTGC  120<br /><font color="#ff0000"><b>Sbjct</b></font>  118  .....<font color="#ff0000"><b>C</b></font>......................................................  177<br />Query  61   TGTCG-TTTTTGGCGGTTTCGAGTTGAACTGCGTTAGTCCGTGCGCTGTTCGCAAGTGTG  119<br /><font color="#ff0000"><b>Sbjct</b></font>  160  .....<font color="#ff0000"><b>T</b></font>...............................<font color="#ff0000"><b>-</b></font>......................  102<br />Query  61   TTAATTTTAAGCCGTAATTGTCGTTTTTGGCGGTTTCGAGTTGAACTGCGTTAGTCCGTG  120<br /><font color="#ff0000"><b>Sbjct</b></font>  181  ...........................<font color="#ff0000"><b>C</b></font>................................  122<br /><br /><br /><br />

• Detected sequencing error, correction needed for the reference
• Detected alternative haplotype
  

For what it's worth, there are two reasons why it might make sense to force our biggest and most complex banks to hold more capital than their smaller, simpler peers: if big super-banks have the privilege of knowing that we as taxpayers would always bail them out in a crisis, surely they've got to put in place treble protection against the risk that they'd call on us for such help; also the costs of holding the extra capital might encourage them to slim down and simplify their operations.

Polymorphism Data Can Reveal the Origin of Species Abundance Statistics

1. UniprotKB/Swiss-Prot
2. NCBI RefSeq proteins and mRNAs
3. UniprotKB/TrEMBL
4. EMBL Nucleotide Sequence Archive

• perfect
• added start
• longer region
• missing start
• non-matching start
• non-matching region
• shorter region
• ...

A new drug which shows promise as a treatment for Alzheimer's disease has been developed by UK scientists.

The Proceedings of the National Academy of Sciences reports the drug, CPHPC, removes a protein thought to play a key role in Alzheimer's from the blood.

Tests at the University College London found the protein also disappeared from the brains of five Alzheimer's patients given the drug for three months.

Longer and larger scale clinical studies are now being planned.

Tories to break up banks?

Robert Peston | 12:40 UK time, Wednesday, 8 April 2009

Royal Bank of Scotland and Lloyds TSB could be dismantled after the next election, if the Tories form the government.

George OsborneHere's why I say that, in the form of excerpts from a speech that's just been delivered by George Osborne, the Shadow chancellor.

"We cannot allow one part of our economy to behave in a way that puts the rest of the economy at risk when it fails. We need to think deeply about whether we can sustain banks that are not only too big to fail, but potentially too big to bail.

By dint of its substantial shareholdings the government has a powerful influence over the future structure of the UK banking industry, whether it likes it or not.

When the time comes to sell off those shareholdings we need to think very carefully before simply selling them to the highest bidder without thinking through the consequences for the wider economy.

We should look at whether Britain in fact needs smaller banks.

For it would be a bitter irony if we came out of this crisis with a banking system that was even more concentrated and even riskier than the one we had before it."

The background to these remarks is that Royal Bank's balance sheet is considerably bigger than the total output of the British economy and it liabilities are considerably great than the entire public-sector debt of the UK.

Hence Osborne's allusion to banks that are "too big to bail". Or to put it another way, in rescuing RBS, the government has mortgaged all our economic futures to the rehabilitation of this giant bank.

As for Lloyds, it became far and away the biggest retail bank in the UK when it was permitted to buy HBOS last autumn.

In fact, it only rescued battered HBOS because the deal offered a once-in-a-generation opportunity to become the unchallenged market leader in British retail banking.

So if the next government were to dismantle Lloyds, depriving it of its enormous share of the current-account, savings and mortgage markets, that would be a reputational disaster for Lloyds' management.

There are two further implications of Osborne's remarks: first, that he would privatise Northern Rock as an independent bank, rather than flogging it to another bank; second, that he would ask the City watchdog, the FSA, and the competition authorities to consider whether other big British banks should be broken up. Even those where taxpayers don't have a big stake.

In the City, where I am tapping out this blog, this is big stuff.

To do my normal thing of ramming home the bleedin' obvious, the opinion polls are currently saying Osborne will be the next chancellor. Which means that his ambitions for what our banks should look like after the spring of next year are at least as significant as the future plans of the current chancellor.

The Tammar Wallaby (Macropus eugenii), also known as the Dama Wallaby or Darma Wallaby, is a small member of the kangaroo family and is the type species for research on kangaroos and marsupials.

It is found on offshore islands on the South Australian and Western Australian coast. It is classified as vermin on Kangaroo Island, where it seasonally breeds in large numbers and damages the echidna habitat on the island.

• HGNC has made great progress in solving nomenclatures for 130 cases where the community has a diversity of opinions and it's difficult to agree on something. Very good point in saying that in the Internet era it's better to give a gene a name that is distinctive to common words that would clobber your Google search results. There is now a forum set up for different communities to use in discussions for gene family names.
• Havana now has started using RNAseq data to confirm new genes found in human and zebrafish that didn't have evidence before. One new feature is a "confirmed intron" for when paired Solexa reads bridge two exons, with an associated score for read depth. Confident this type of data will bring out many interesting new annotations that couldn't be found before, e.g. genes expressed in a given tissue during a lapse of a few hours in the development. There are already a few examples in zebrafish.
• Wormbase has been working hard on compiling more data from the modENCODE. Small but cool infrastructure achievement in having VMware images running for old releases that investigators can just pull and bring up on demand.
• Ensembl Genomes has been successfully testing the beta sites for Bacteria, Protists and the first Metazoa build. Another Metazoa build is in progress, with all the phylogenetics goodness of the 12 Drosophila genomes plus the vectors plus C.elegans and a few other outgroups. The modENCODE project is about to complete the re-annotation of gene models using CAGE data that will bring more precise gene starts for melano and elegans. Ensembl Genomes is still working together with Manchester and now the US to put together an Aspergillus resource that provides the best value for money to researchers. PombBase is also being pursued, lots of labs interested in having it Ensemblified and ready to use.

The ape package written by Emmanuel Paradis is the foundation for phylogenetic analyses in R. Yesterday, Paradis and his coauthors posted a new version (3.2) on the CRAN archive yesterday. There don't seem to be too many new functions, but there are some important bug fixes. One these - preventing calculation of negative state probabilities when reconstructing discrete character states - solves one of the more vexing problems I've had with the ace function. You should definitely get the update if you're doing ancestral reconstruction of discretely coded traits! Now we just need to hope the April 17th upgrade to R 2.9 goes smoothly...

According to the school's Information Technology & Communication department, 3,117 freshmen enrolled in 2007, and 3,113 of them owned their own computer. Nearly all of the machines were laptops, with 72 percent running Windows and 26 percent running Mac OS X (six hardy souls ran Linux).

Sugarcane genes associated with sucrose content.

Papini-Terzi FS, Rocha FR, Vencio RZ, Felix JM, Branco DS, Waclawovsky AJ, Del Bem LE, Lembke CG, Costa MD, Nishiyama MY Jr, Vicentini R, Vincentz MG, Ulian EC, Menossi M, Souza GM.

ABSTRACT: BACKGROUND: Sucrose content is a highly desirable trait in sugarcane as the worldwide demand for cost-effective biofuels surges. Sugarcane cultivars differ in their capacity to accumulate sucrose and breeding programs routinely perform crosses to identify genotypes able to produce more sucrose. Sucrose content in the mature internodes reach around 20% of the culms dry weight. Genotypes in the populations reflect their genetic program and may display contrasting growth, development, and physiology, all of which affect carbohydrate metabolism. Few studies have profiled gene expression related to sugarcanes sugar content. The identification of signal transduction components and transcription factors that might regulate sugar accumulation is highly desirable if we are to improve this characteristic of sugarcane plants. RESULTS: We have evaluated thirty genotypes that have different Brix (sugar) levels and identified genes differentially expressed in internodes using cDNA microarrays. These genes were compared to existing gene expression data for sugarcane plants subjected to diverse stress and hormone treatments. The comparisons revealed a strong overlap between the drought and sucrose-content datasets and a limited overlap with ABA signaling. Genes associated with sucrose content were extensively validated by qRT-PCR, which highlighted several protein kinases and transcription factors that are likely to be regulators of sucrose accumulation. The data also indicate that aquaporins, as well as lignin biosynthesis and cell wall metabolism genes, are strongly related to sucrose accumulation. Moreover, sucrose-associated genes were shown to be directly responsive to short term sucrose stimuli, confirming their role in sugar-related pathways. CONCLUSION: Gene expression analysis of sugarcane populations contrasting for sucrose content indicated a possible overlap with drought and cell wall metabolism processes and suggested signaling and transcriptional regulators to be used as molecular markers in breeding programs. Transgenic research is necessary to further clarify the role of the genes and define targets useful for sugarcane improvement programs based on transgenic plants.

• Viella
• Villela