tag:blogger.com,1999:blog-82242262024-03-19T09:08:10.382+00:00castanyes blavesRandom ramblings about some random stuff, and things; but more stuff than things -- all in a mesmerizing and kaleidoscopic soapbox-like flow of words.Unknownnoreply@blogger.comBlogger1025125tag:blogger.com,1999:blog-8224226.post-72034752327743037552011-02-13T19:33:00.001+00:002011-02-13T19:33:01.734+00:00Movies<p><strong>Role models</strong>: great potential, but not fully developed.</p><p><strong>Gulliver's travels</strong>: Jack Black bang-on comedy. Not enough Amanda Peet in the movie.</p><p><strong>Life as we know it</strong>: pseeee...</p><p><strong>Miracle at St. Anna</strong>: great surprise. Terrible ending but enjoyable otherwise.</p><p><strong>Inside Man</strong>: great script and well executed, it could have been a great hit.</p><p><strong>The Break-Up</strong>: seen it for the fifth time, it's a very special movie.</p><p><strong>Tropic Thunder</strong>: Jack Black is great on it but not well rounded-up altogether film.</p><p><strong>Red</strong>: great cast, classic action movie.</p><p><strong>Keeping the faith</strong>: who would have thought that master of comedy would also be able to play on a romantic setting.</p><p><strong>The American</strong>: on the sad side, I like what G.C. has turned into with age. Very sexy co-star, although the film has an abrupt finish that doesn't help in getting close to the characters.</p><p><strong>Forgetting Sarah Marshall</strong>: very enjoyable, unpretentious comedy.</p><p><strong>Hot Tub Time Machine</strong>: too much in-your-face at times, but laughable comedy.</p><p><strong>What Happens in Vegas</strong>: does what it says on the tin.</p><p><strong>The Switch:</strong> there is something I can't digest about this movie, although I understand why people want to like it.</p><p><strong>Rumor Has It:</strong> good comedy which wants to be a bit too dramatic at times.</p><p> </p>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-45500530856579616862010-11-15T09:24:00.001+00:002010-11-15T09:24:58.678+00:00EMBL Postdoc retreat 2010 -- some notes<p>The EMBL Postdoc Retreat 2010 took place in Lubeck. Here are some notes and keywords for some of the seminars:</p><p><strong>Timothy Sauders, EMBL-Heidelberg</strong><br /><strong>Dissecting a noisy subcellular gradient in fission yeast</strong></p><p>EIPOD Timothy Saunders, collaborators Martin Howard (JIC), Eileen Furlong. Image analysis project. POM1. Agreggates. FRAP.</p><p><strong>Kevin Knoops, EMBL-Grenoble</strong><br /><strong>Utrastructural analysis of the nidovirus replication complex</strong><br /><strong>reveals an unique reticulovesicular network of modified</strong><br /><strong>endoplasmic reticulum</strong></p><p>New postdoc, presented previous project at U.Leiden (NL). EM tomography techniques. 300nM coronavirus. Vesicles connected to the rough ER.</p><p><strong>Ciaran Carolan, EMBL-Hamburg</strong><br /><strong>Combination of advanced shape description methodologies for the</strong><br /><strong>identification of ligands and for drug design</strong></p><p>Victor Lamzin, Hamburg. Gerrit Langer, Janet Thornton, Abdullarh Kahraman, Roman Laskowski. Institutions: EBI, St.Jude's Hospital, Malaria DB.</p><p>Lead generation -- bottleneck in drug design</p><p>Protein pocket -> shape -> shape features -> feature match</p><p>Surfnet program. Math descriptors, like Zernike moments, 3rd order moments. Matrix-based shape measures. Electrostatics. ATOLL database.</p><p><strong>Daniel Fernández, EMBL-Grenoble</strong><br /><strong>Structural analysis of stress tolerance proteins in plants</strong></p><p>Jose Antonio Marquez Group - Grenoble, IBMCP - Valencia, Regina Antoni, Pedro Rodriguez</p><p>C2 Domain proteins. ABA receptor: PYR, PYL, RCARs. Humidity control device</p><p><strong>Virginia van Delinder, EMBL-Heidelberg</strong><br /><strong>Single-molecule TIRF without immobilization</strong></p><p>Lemke Lab.</p><p>FRET distance between molecules. Microfluidics. Single-molecule FRET is tough. CFP-YFP pairs: cyan+yellow = green</p><p>PDMS device (channels). Droplet generation: 8 micron deep channels. Gave up on droplets, continuous channels.</p><p><strong>Joseph Barry, EMBL-Heidelberg</strong><br /><strong>Mathematical modeling of protein aging and turnover in live</strong><br /><strong>yeast cells</strong></p><p>EIPOD, Huber Group Heidelberg, Knop Group, Andreas Kaufmann</p><p>Computational physics</p><p>Snapshot Analysis Protein Stability SAPS. Protein-mCherry-sfGFP (43min, 5min)</p><p>Colour 1 -> snapshots -> colour 2</p><p>Genome-wide library of yeast strains. One protein tagged each time. MCD1 protein-cell cycle.</p><p>R package - deSolve</p><p><strong>Jan Medenbach, EMBL-Heidelberg</strong><br /><strong>A novel and general concept for the regulation of translation by</strong><br /><strong>protein-controlled upstream open reading frames (pc-uORFs)</strong></p><p>M.Hentze lab Heidelberg</p><p>msl-2. SXL</p><p><strong>Chris Williams, EMBL-Hamburg</strong><br /><strong>Insights into the regulation of an E2 enzyme by a non-</strong><br /><strong>canonical binding partner</strong></p><p>Structural Biology Unit, Matthias Wilmanns, Hamburg</p><p>Pex22 novel fold. No homologues in PDB. Y172A mutation blocks PEX4P-PEX22 binding</p><p><strong>Pierre Khoueiry, EMBL-Heidelberg</strong><br /><strong>Defining functionality and essentiality in the Drosophila</strong><br /><strong>mesoderm network using inter- and intra-species comparisons</strong></p><p>Eileen Furlong. Doing both wetlab and bioinformatics analysis</p><p>8008 CRMs mesoderm defined with about ~5 per gene -> need to purify this list</p><p>Mesoderm CRMs should be evolutionarily conserved</p><p>D.virilis ~50MYA from D.melanogaster</p><p>Compare network mel vs vir -> missing genes / new genes</p><p>Data from indels -- Jan Korbel lab</p><p>SVs/CNVs -> create regulatory changes</p><p>When we find an indel in a CRM -> might be affected by it -> redundancy -> property of CRMs</p><p>Hypothesis: developmental CRM deletions are lethal, they are supposed to avoid SVs</p><p>If one deleted, but others next to it -> still functional, redundancy in action, or not functional anymore</p><p><strong>Andres Palencia, EMBL-Grenoble</strong><br /><strong>Role of aminoacyl-tRNA synthetases in protein synthesis.</strong><br /><strong>Case study: structural dynamics of the aminoacylation and proof-</strong><br /><strong>reading cycle of leucyl-tRNA synthetase</strong></p><p>Bacterial LeuRS as a model</p><p><strong>Sebastian Glatt, EMBL-Heidelberg</strong><br /><strong>"Ring"ulation of tRNA modification</strong></p><p>Elp 4-5-6 complex. Elp 1-2-3</p><p>Rho-ssRNA, bind ssRNA, same structure as elongator. Asymmetric central cavity using heterohexameric assembly.</p>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-82993979193941756442010-09-05T20:50:00.001+01:002010-09-05T20:50:29.190+01:00Alcohol consumption in Europe<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://www.bbc.co.uk/news/uk-11170814'>BBC News - Alcohol consumption 'continues to fall'</a><br/><blockquote>2008 alcohol consumption in Europe (litres per head)<br/><br/> * Czech Republic - 12.3<br/> * Austria - 10.4<br/> * Lithuania - 10.1<br/> * Germany - 10.0<br/> * Spain/Hungary - 9.8<br/> * Portugal/Slovakia/Denmark - 9.3<br/> * Poland - 9.8<br/> * Belgium/Luxembourg - 8.5<br/> * UK - 8.4<br/> * Finland/Greece - 7.6<br/><br/>Source: BBPA Statistical Handbook 2010</blockquote></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-8923774075228579402010-07-22T09:18:00.001+01:002010-07-22T09:18:48.040+01:00Lab life and ecology<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://proflikesubstance.blogspot.com/2010/07/job-data-in-ecology-and-evolution.html'>Prof-like Substance: Job data in ecology and evolution fields</a><br/><blockquote>Euphemisms called “labs” coexist in structured universal aggregations where they compete with one another for scarce resources. Labs cooperate to produce copious numbers of zygotes, most of which disperse synchronously each year. The strongest find their way into the protective brood pouches of crusty adults who shed soft-shelled offspring at regular intervals (slowly developing zygotes die by the incompletely understood process of academic apoptosis). Juveniles develop a hard external carapace by intermittently joining and extracting themselves from other labs. The hardened but vulnerable sub-adults then join a common pool where they compete for space and position on rapidly eroding substrate in the universal aggregation. Many become dormant and fail to contribute to the gene (meme) pool. Some return to the lab as brood-rearing helpers. Few survive the rampant competition and frenzied cannibalism in the pool. Not all of the survivors are safe on the fragile substrate. A second apoptosis-like event eliminates the weak and meek. Only the most persistent or aggressive remain.</blockquote></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-45600523351821229012010-04-24T20:37:00.001+01:002010-04-24T20:37:17.074+01:00Pay per view, football and statistics<div xmlns='http://www.w3.org/1999/xhtml'>A very interesting web application that studies the score distributions for different football leagues:<br/><a href='http://understandinguncertainty.org/node/228'>http://understandinguncertainty.org/node/228</a><br/>Something that people already know is that Pay-per-view TV had a major impact in how different teams performed in different years. In the early 2000's, many more teams in Spain, Italy and UK had a chance to sign highly-payed players, because they were receiving the monetary influx from Pay-per-view TV. That narrowed the differences among the traditionally best-performing teams, and a group of teams that were traditionally in middle-of-the-table positions. Some teams were better at investing this influx of money than others, and this meant they had much better chances of winning the national league. But as Pay-per-view normalized, and teams with the highest media interest got back at receiving more money than the rest of the teams, sharp differences reappeared.<br/>See for example the results for the Spanish League in 2000-2001: the variance due to chance went up to <b>60%</b>.<br/><img src='http://lh4.ggpht.com/_VMsVwHYr1_M/S9NG2erfQGI/AAAAAAAABRU/YQd_6BhC6lc/%5BUNSET%5D.png?imgmax=800' style='max-width: 800px;'/><br/>Whereas last year: Barcelona and Real Madrid quickly dominated the scoreboard, and the % variance due to chance ended at <b>34%</b>.<br/><img src='http://lh4.ggpht.com/_VMsVwHYr1_M/S9NHXepTSyI/AAAAAAAABRY/tm8dxaeQWVw/%5BUNSET%5D.png?imgmax=800' style='max-width: 800px;'/><br/>Italy before the referee scandal was down to 18%:<br/><img src='http://lh5.ggpht.com/_VMsVwHYr1_M/S9NIZrq3f6I/AAAAAAAABRc/Z1ie0V42BPk/%5BUNSET%5D.png?imgmax=800' style='max-width: 800px;'/><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=3617d864-b205-8884-8daf-582cc3274717' alt='' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-53744368102035546452010-04-13T13:07:00.001+01:002010-04-13T13:07:24.807+01:00Financial bonuses<div xmlns='http://www.w3.org/1999/xhtml'>Long time, no post. Here is a financial one: Vince Cable (LibDem UK) on bank bonuses. Many many people would subscribe to these rules. That is not the problem. Politicians will say: if there is multinational agreement on these rules, let's apply them. The very moment when one important country decides not to go for them, then it's war. War many centuries ago was about having a fleet of ships with cannons, then it turned into air force, then into nuclear weaponry. Nowadays, it's a financial war. For example, reams of paper being written about artificial devaluation of the currency in China. This is as close as a Cold War as it was two decades ago.<br/><br/><a href='http://www.bbc.co.uk/blogs/thereporters/robertpeston/2010/04/lib_dems_smaller_bonuses_small.html'>BBC - Peston's Picks: Lib Dems: Smaller bonuses, smaller City?</a><br/><blockquote>These are the highlights:<br/><br/>1) All bonuses over £2,500 would be payable in shares, which couldn't be redeemed, or pledged as security for loans or turned into anything spendable for at least five years.<br/><br/>2) No one on the board of a bank, not even the chief executive, would be eligible for a penny of bonus.<br/><br/>3) Loss-making banks would be banned from paying bonuses.<br/><br/>4) Every employee of a bank earning more than the prime minister - which Mr Clegg defines as circa £200,000 - would be publicly named.</blockquote><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=e0bc8adc-2473-82b4-8afd-2c1d3a97b136' alt='' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-80349710557304204912010-03-26T09:04:00.001+00:002010-03-26T09:04:22.407+00:00Google Summer of Code 2010: interesting phyloinformatics projects<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://socrates2.cgl.ucsf.edu/GenMAPP/wiki/Google_Summer_of_Code_2010'>Google_Summer_of_Code_2010 – GenMAPP</a><br/><blockquote>IDEA 12: Phylogenetic Tree plugin ¶<br/><br/>Most of the software for visualization of phylogenetic tree is command line driven. Cytoscape's enhanced graphical abilities can be used to layout a phylogenetic tree, zoom a region, assign colors to groups of nodes and edges, generates publication-quality images. A Cytoscape plugin (PhyloTreePlugin) could become very useful tool for scientists studying phylogenetic trees. A student (GSoC 2009) already implemented some algorithms to visualize the rooted trees, this year we want to extend the plugin to support the visualization of un-rooted tree to make the plugin complete. The task includes the support of more format of phylogenetic tree and implements more algorithms for visualization of phylogenetic tree.<br/><br/>Language and skills: Java<br/><br/>Idea by: Peng Liang Wang<br/><br/>Potential Mentors: Peng Liang Wang, Scooter Morris, sign up here</blockquote><a href='https://www.nescent.org/wg/phyloinformatics/index.php?title=Phyloinformatics_Summer_of_Code_2010'>Phyloinformatics Summer of Code 2010 - Phyloinformatics</a><br/><blockquote>Phylomovies: interactive animations of gene tree evolution<br/><br/>This project would produce a tool useful for both science and outreach, and which could ultimately become linked with the Ensembl database and be used by thousands of biologists worldwide every day.<br/><br/>Rationale <br/> Evolving DNA is usually represented by static pictures, like trees, that are sometimes difficult to decipher. A movie is a more natural medium for presenting the evolutionary processes that shape the genomes of all living species. Comparative genomics databases such as Ensembl, Pfam, and HomoloGene use large amounts of data and powerful inference methods to construct highly-resolved evolutionary histories of individual gene families, including the characteristic patterns of duplication and speciation leading to the gene content observed today. However, the static nature of image-based visualizations can make the interpretation of such "gene family trees" a bit difficult. <br/><br/> In the same way that the Google-acquired Trendalyzer technology uses animation to clarify and expose trends in economic data, an evolutionary movie would help scientists and the public better understand the meaning and importance of evolutionary data. <br/>Approach <br/> The goal of this project would be to create an online widget that loads gene tree data in standard formats (XML / NHX format trees) and generates an interactive movie, allowing users to temporally navigate through the evolution of a given gene family. This would involve the design, implementation and exhibition of a novel visualization interface. <br/><br/> In terms of implementation, one option would be to use the PhyloWidget codebase as a starting point, although other options (such as Flash) should be considered, depending on the student's expertise. A mock-up animation of the evolution of the Tropomyosin gene can be found here. Animations relating a gene tree can also be found here [1]. <br/><br/> Possible extensions to the tool would include the incorporation / correlation of species tree information and divergence time estimates, and exporting animations to non-interactive movie formats. <br/>Challenges <br/><br/> * (medium) Identify the most appropriate libraries and tools to work with<br/> * (hard) Define and implement a system for converting static phylogenetic trees (and associated metadata) into animations<br/> * (medium-to-hard) Create an interface for visualizing / exploring / exporting the animations <br/><br/>Involved toolkits or projects <br/><br/> * Possible languages: Java, Flash, Javascript<br/> * Possible toolkits / libraries: PhyloWidget, Archaeopteryx, ScripTree <br/><br/>Degree of difficulty and needed skills <br/> Medium. Will require creative thinking, interface design, and solid background in a client-side browser language (Java, JavaScript or Flash). <br/>Other topics<br/> Any alternative proposals aimed towards improving the "accessibility" of phylogenetic trees to non-specialist audiences are encouraged. Also, alternative proposals would include implementing new methods for visualizing biological data on trees: e.g., bootstrap values / tree uncertainty, population size estimates, or uncertainty in divergence times. <br/>Mentors <br/> Gregory Jordan (PhyloWidget), Albert Vilella (Ensembl Compara) </blockquote><a href='https://www.nescent.org/wg/phyloinformatics/index.php?title=Phyloinformatics_Summer_of_Code_2010'>Phyloinformatics Summer of Code 2010 - Phyloinformatics</a><br/><blockquote>Google maps-like multi-genome browsing in Jalview<br/><br/>Rationale <br/> The amount of genomic data is increasing exponentially since the advent of the next generation sequencing techniques. New visualizations tools are needed to be able to compare genomic data at multiple resolutions in a natural way. One way to do this would be to adopt user interaction principles from successful multi-resolution interfaces, such as Google Maps. <br/>Approach <br/> Most problems with Jalview's interface become obvious when working with large alignments. An initial examination of the UI issues should first be made, and some solutions proposed to improve the user's experience when working with large alignments (and trees). These solutions should then be prototyped using a snapshot of the current Jalview 2.X codebase so their effectiveness can be assessed by expert users. <br/>Challenges <br/><br/> * (easy/medium) adapting Jalview's existing multi-window visualizations implemented in AWT and Swing<br/> * (hard) efficient multiscale rendering of very large multiple sequence alignments<br/> * (medium/hard) solving the memory and rendering issues that arise when interactively visualizing and editing very large alignments. <br/><br/>Degree of difficulty and needed skills <br/> Medium to hard. Java. Experience with either or both AWT and Swing. Some familiarity with low level file handling, or alternately, experience with handling datasets with many thousands of sequences (e.g. with Picard). <br/>Other Topics<br/> There are plenty of other areas to work on in Jalview - topics include AJAX and DAS (extending the JalviewLite for working with DAS annotation servers), Phylogenetic visualization (wider tree format support and better interactive visualization) and extending support for RNA (linked secondary structure visualization, alignment and analysis services). Please contact the Mentors for further information. <br/>Mentors <br/> Jim Procter and Albert Vilella</blockquote></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-26028469616307219242010-03-02T13:04:00.001+00:002010-03-02T13:04:00.316+00:00Brain evolution @ news.bbc.co.uk<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://news.bbc.co.uk/1/hi/health/8543906.stm'>BBC News - Did the discovery of cooking make us human?</a><br/><blockquote>Cooking is something we all take for granted but a new theory suggests that if we had not learned to cook food, not only would we still look like chimps but, like them, we would also be compelled to spend most of the day chewing.</blockquote></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-17944242725934458622010-02-05T13:55:00.001+00:002010-02-05T13:55:20.225+00:00Paul Krugman on Spanish finances<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://krugman.blogs.nytimes.com/2010/02/05/the-spanish-tragedy/'>The Spanish Tragedy - Paul Krugman Blog - NYTimes.com</a><br/><blockquote><div class='entry-content'> <div class='w480'><img alt='DESCRIPTION' src='http://www.princeton.edu/%7Epkrugman/euro_debt.gif'/><span class='credit'>OECD</span> <span class='caption'>Government debt as % of GDP</span></div> <p>As Europe is roiled by sovereign debt fears, it’s important to realize that the crisis in the largest of the PIIGS (Portugal, Ireland, Italy, Greece, Spain) has nothing to do with fiscal irresponsibility. On the even of the crisis, Spain was running a budget surplus; its debts, as you can see in the figure above, were low relative to GDP.</p> <p>So what happened? Spain is an object lesson in the problems of having monetary union without fiscal and labor market integration. First, there was a huge boom in Spain, largely driven by a housing bubble — and financed by capital outflows from Germany. This boom pulled up Spanish wages. Then the bubble burst, leaving Spanish labor overpriced relative to Germany and France, and precipitating a surge in unemployment. It also led to large Spanish budget deficits, mainly because of collapsing revenue but also due to efforts to limit the rise in unemployment.</p> <p>If Spain had its own currency, this would be a good time to devalue; but it doesn’t.</p> <p>On the other hand, if Spain were like Florida, its problems wouldn’t be as severe. The budget deficit wouldn’t be as large, because social insurance payments would be coming from Brussels, just as Social Security and Medicare come from Washington. And there would be a safety valve for unemployment, as many workers would migrate to regions with better prospects. (Wages wouldn’t have gone up as much in the first place, because of in-migration).</p> <p>The point is that this has nothing to do with a spendthrift government; what’s happening to Spain reflects the inherent problems with the euro, which now more than ever looks like a monetary union too far.</p> </div></blockquote><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=6e5ee453-3531-89fa-a42f-ddfa7089c0b7' alt='' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-49654343757352493962010-02-01T09:59:00.001+00:002010-02-01T09:59:20.664+00:00UK is not Greece -- Peston's Picks<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://www.bbc.co.uk/blogs/thereporters/robertpeston/2010/02/tories_withdraw_support_from_t.html'>BBC - Peston's Picks: Tories withdraw support from the gilt market</a><br/><blockquote>To be clear, there is no direct read-across (to use the dreadful business cliche) from Greece's acute difficulties in borrowing: the UK's finances are in better shape than Greece's, the UK economy is more flexible than Greece's and there isn't international pressure on the UK to improve the accuracy and reliability of government book-keeping.</blockquote><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=e06ca778-4b62-8034-8305-db0a7b52fb7e' alt='' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-61118405416101323372010-01-17T20:01:00.001+00:002010-01-17T20:01:27.878+00:00<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://dictionary.reference.com/browse/pull+someone%27s+chestnuts+out+of+the+fire'>Pull someone's chestnuts out of the fire Definition | Definition of Pull someone's chestnuts out of the fire at Dictionary.com</a><br/><blockquote>Idiom<br/>12. pull someone's chestnuts out of the fire, to rescue someone from a difficulty.</blockquote><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=a5996eeb-ba48-8580-9b6f-d6414fcc0c8f' alt='' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-91958038260344461762009-12-15T11:57:00.001+00:002009-12-15T11:57:42.757+00:00I knew this could be done!!!<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://www.nytimes.com/2009/12/15/science/earth/15bike.html?partner=rss&emc=rss'>For Bicyclists Needing a Boost, This Wheel May Help - NYTimes.com</a><br/><blockquote>PD: I want one!<br/><br/><img src='http://graphics8.nytimes.com/images/2009/12/15/science/15bike_graphic/popup.jpg' style='max-width: 800px;'/><br/></blockquote><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=6e702eb2-24ae-834a-97a1-77a3cfa6de25' alt='' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-45962458259278548932009-09-27T17:29:00.001+01:002009-09-27T17:29:48.765+01:00Paul Krugman explains cap-and-trade<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://krugman.blogs.nytimes.com/2009/09/27/the-textbook-economics-of-cap-and-trade/'>The textbook economics of cap-and-trade - Paul Krugman Blog - NYTimes.com</a><br/><blockquote><div class='entry-content'> <p>I realized, after <a href='http://krugman.blogs.nytimes.com/2009/09/25/pigou-glenn-beck-and-the-false-case-against-cap-and-trade/'>the last post</a>, that it might be useful to write down just what the Econ 101 version of cap and trade looks like; as it happens, this also helps explain the intellectual sins of Glenn Beck and Martin Feldstein.</p> <p>So here we go. Bear in mind that something like what follows can be found in just about every intro textbook.</p> <p>Think of the benefits to the private sector from pollution. Yes, benefits — in the sense that it’s cheaper to pollute than not to, or that it’s easier to produce goods if you don’t worry about whatever emissions result as a byproduct. So we can think of drawing a curve representing the <em>private marginal benefit</em> of emissions, as in this figure:</p> <p><webonly> </webonly></p><div class='w480'><img alt='DESCRIPTION' src='http://www.princeton.edu/%7Epkrugman/capandtrade.png'/><span class='credit'/> <span class='caption'/></div> <p>In the absence of government action, the private sector will increase emissions up to the point where there is no further marginal benefit. That is, emissions will rise to whatever level is implied by profit-maximization, paying no attention to the effects on the environment.</p> <p>A cap-and-trade system puts a limit on overall emissions, so that emitters have to pay a price for emitting. This price will, as shown in the figure above, equal the marginal benefit of the last unit of emissions allowed.</p> <p>Now, the cost to the economy of this limit is the benefit the private sector would have gotten by emitting more than is allowed under the cap. It’s shown in the figure as the red triangle labeled “deadweight loss”. CBO <a href='http://www.cbo.gov/ftpdocs/105xx/doc10573/09-17-Greenhouse-Gas.pdf'>puts these losses </a> under Waxman-Markey at 0.2-0.7 percent of GDP in 2020, 1.1 to 3.4 percent in 2050. These costs have to be set against the environmental benefits.</p> <p>In addition to this overall economic cost, there’s a distributional effect. The creation of cap and trade means that emission permits command a market price, and the value of these permits — the blue rectangle — goes to someone. Under Waxman-Markey, some of it (a growing fraction over time) would be captured by the government through auctions, and used to cut or avoid increases in other taxes — in effect, recycled to consumers. The rest would be passed on to industry — but because the biggest recipients would be regulated utilities, much of this would also be passed on to consumers.</p> <p>OK, now let’s send in Beck and Feldstein.</p> <p>Beck got his number from someone who learned about a guesstimate of what the auction value of permits might be (way higher than current estimates, by the way), divided by the number of households, and proclaimed this the cost of the bill. In effect, he looked at a guess about the size of the blue rectangle, which does <em>not</em> represent an economic cost, and called that the cost to the economy.</p> <p>In a way, though, what Martin Feldstein did was worse. He took the CBO’s estimate of “compliance costs”, which was $1600 per household in an early report (it’s now down to $900, but who’s counting?), and implied that this was the economic cost of the legislation. But “compliance costs” are basically the sum of the blue rectangle and the red triangle; the true economic costs are just the triangle, and are much smaller.</p> <p>Another way to say this is that under the Feldstein method, any time you try to correct an externality, which necessarily means changing relative prices, all of the negative effects of the price change will be counted as a cost — but none of the positive effects will be counted as a benefit.</p> <p>Bad stuff. And what you should bear in mind is that all I’m doing here is conventional neoclassical economics, quite literally basic textbook material. What does it say when the people who claim to believe in this stuff throw it out the window as soon as it leads to policy conclusions they don’t like?</p> </div></blockquote><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=81c35262-7fe8-80fb-b1b2-8e5e2fbf6ca2' alt='' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-19059585733227612352009-08-06T13:27:00.001+01:002009-08-06T13:27:44.594+01:00Caption competition<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://www.bbc.co.uk/blogs/magazinemonitor/2009/08/caption_competition_94.shtml'>BBC - Magazine Monitor: Caption Competition</a><br/><blockquote>Caption Competition<br/><span class='comment-number'>12. </span><cite>At <a name='comment12' href='http://www.bbc.co.uk/blogs/magazinemonitor/2009/08/caption_competition_94.shtml#P83913582' class='time'>12:31pm</a> on <span class='date'>06 Aug 2009</span>, <span class='vcard'><span class='fn'><a href='http://www.bbc.co.uk/blogs/profile?userid=12483588'>LaurenceLane</a></span></span> wrote:</cite><p class='comment-text'> The PGA have been urged to rule on the use of polyurethane suits by spectators, even if rain has been forecast.</p><br/><abbr title='2009-08-06T12:00:46+00:00' class='published'>12:00 UK time, Thursday, 6 August 2009</abbr> <div class='cleardiv'/> <p><span style='display: inline;' class='mt-enclosure mt-enclosure-image'><img height='450' width='595' style='margin: 0pt auto 20px; text-align: center; display: block;' class='mt-image-center' src='http://www.bbc.co.uk/blogs/magazinemonitor/cap.595.jpg' alt='cap.595.jpg'/></span></p><br/></blockquote><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=17cdb2b3-e094-8909-b616-5c123541b168' alt='' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-17443267431732956072009-07-02T11:09:00.001+01:002009-07-02T11:09:26.805+01:00What a NGS IT person should be skilled in<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://www.ploscompbiol.org/article/info%3Adoi%2F10.1371%2Fjournal.pcbi.1000369'>PLoS Computational Biology: Managing and Analyzing Next-Generation Sequence Data</a><br/><blockquote>The skills necessary within the Facility include the following.<br/><br/> 1.<br/><br/> An intimate knowledge of UNIX-based operating systems.<br/> 2.<br/><br/> Understanding of a scripting language such as Perl.<br/> 3.<br/><br/> An understanding of parallel computing environments for UNIX clusters.<br/> 4.<br/><br/> Knowledge of network-based data storage.<br/> 5.<br/><br/> General knowledge of biology and genome sciences.<br/> 6.<br/><br/> Ability to derive data analysis and software requirements from investigators who do not have a sophisticated understanding of information technology.<br/> 7.<br/><br/> Ability to develop software encapsulating new analysis methods.<br/> 8.<br/><br/> Understanding of relational databases and database architecture.<br/> 9.<br/><br/> Ability to seek out and test novel bioinformatics software and analysis routines.</blockquote><br/><br/></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-17005913216402726852009-06-24T10:51:00.001+01:002009-06-24T10:51:54.628+01:00Lamprey Genome rearrangements<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://www.genomeweb.com//node/919126?emc=el&m=424765&l=1&v=41ab930077'>DNA Jettisoned From Lamprey Genome During Development | GenomeWeb Daily News | Sequencing | GenomeWeb</a><br/><blockquote>Amemiya and his co-workers became suspicious that the lamprey's genome structure and composition was changing during development when they heard rumors lamprey genome sequences efforts were being complicated by genome fragmentation. They speculated that this might be due to genome rearrangements similar to those described for the hagfish, a chordate and superficially similar organism.<br/><br/>To test this, the researchers compared germ line and somatic tissues from sea lamprey caught in Lake Michigan.<br/><br/>Indeed, they found that the genome was larger in sperm (germ line cells) than in adult blood nuclei (somatic cells), even within the same individual. The sperm cells also contained more DNA than kidney and liver cells, which both had similar DNA content to red blood cells. Overall, the researchers noted, sperm genomes contained some 20 percent more DNA than adult cells such as red blood cells. </blockquote><br/><br/></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-50458773703100603732009-06-12T13:48:00.001+01:002009-06-12T13:48:52.662+01:00<div xmlns='http://www.w3.org/1999/xhtml'><a href='http://www.genomeweb.com//node/918343?emc=el&m=412905&l=1&v=41ab930077'>Life After GWAS: For Some Researchers, Focus Shifts to Rare Variants, CNVs | GenomeWeb Daily News | Sequencing | GenomeWeb</a><br/><blockquote>Over the last several years, genome-wide association studies have become the primary method for identifying variations associated with human disease, but the approach has shortcomings that are leading some in the genomics community to push more aggressively into the post-GWAS era.<br/><br/>At Cambridge Healthtech Institute's Genomic Tools and Technologies Summit held here this week, many speakers noted that even though GWA studies have linked hundreds of common SNPs to disease, these variants account for only a very small portion of disease heritability, which has raised doubts over their clinical value. A number of talks focused on two key alternatives to GWAS: the discovery of rare variants, as opposed to common variants, with a role in disease; and an increasing focus on copy number variants rather than SNPs.</blockquote><a href='http://www.genomeweb.com//node/918343?emc=el&m=412905&l=1&v=41ab930077'>Life After GWAS: For Some Researchers, Focus Shifts to Rare Variants, CNVs | GenomeWeb Daily News | Sequencing | GenomeWeb</a><br/><blockquote>"GWAS was never meant to substitute for fine genomic sequencing," but rather to identify regions of linkage disequilibrium in the genome that warrant further study</blockquote><a href='http://www.genomeweb.com//node/918343?emc=el&m=412905&l=1&v=41ab930077'>Life After GWAS: For Some Researchers, Focus Shifts to Rare Variants, CNVs | GenomeWeb Daily News | Sequencing | GenomeWeb</a><br/><blockquote>Lupski said that efforts like the 1000 Genomes Project will likely produce valuable information that will drive improvements in the use of sequencing for CNV detection. "It's coming along," he said. "I think this will be solved."</blockquote><br/><br/></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-64899861325819719352009-05-26T08:54:00.001+01:002009-05-26T08:54:55.358+01:00Ubuntu trick -- how to reset evolution email<div xmlns='http://www.w3.org/1999/xhtml'>gconftool-2 --recursive-unset /apps/evolution<br/></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-65965024998926435322009-05-21T16:02:00.001+01:002009-05-21T16:02:48.769+01:00Gene by gene turns genome-by-genome<div xmlns='http://www.w3.org/1999/xhtml'>This is a good example of the kind of paper we are probably going to see more and more often in the future:<br/><br/><small><font size='+1'><small><b>Gene discovery using massively parallel pyrosequencing to develop ESTs for the flesh fly Sarcophaga crassipalpis</b></small></font></small><br/><a href='http://www.ncbi.nlm.nih.gov/pubmed/19454017'>http://www.ncbi.nlm.nih.gov/pubmed/19454017</a><br/><br/>Get (a) a certain amount of RNAseq reads for your species "X", (b) build as many full-length cDNAs as possible from the fragments and (c) compare against close species in terms of:<br/><ul><li>New interesting cDNAs that don't have hits against existing public cDNAs -- What do they do?<br/></li><li>Expression patterns -- Are these different to the patterns in other close species?<br/></li><li>Protein coding evolution -- run pairwise dNdS against closest genome or tree-based dNdS against an <a href='http://www.ncbi.nlm.nih.gov/pubmed/19029536'/>existing phylogeny [<a href='http://www.ncbi.nlm.nih.gov/pubmed/19029536'>1</a>,<a href='http://www.ensemblgenomes.org'>2</a>] -- Does anything show up in a Gene Ontology enrichment analysis?</li></ul>Then the data is published and stored in a publicly available database, and can be added to the pool to compare against for the next project. Iterate :-)<br/><br/>It used to be gene-by-gene sequencing and it's now transcriptome by transcriptome sequencing. There are still sequence error and sequence coverage issues: one of my first scientific mentors, Prof. Montserrat Aguade was one of the first to do gene sequencing on the Adh gene in <i>Drosophila</i> when doing her PhD in Harvard. People then extended Adh sequencing and analysis to other <i>Drosophila</i> species, then other clades, then other genes, then some gene families like odorant binding proteins for a bunch of <i>Drosophila</i> species or populations, or gene pathways like the insulin pathway, etc. <br/><br/>But now we have a much broader picture with a rather complete transcriptome. And most of the sequencing issues are going to be corrected across the phylogeny in pretty much the same way as allele imputation is filling the gaps at the population genomics level (e.g. 1000 Genomes Project).<br/><br/>I am very excited about all this!<br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=a4014992-81b5-85c5-9d03-84cc6a1d7514' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-54767235769114200302009-05-11T10:33:00.001+01:002009-05-11T10:33:25.444+01:00Anolis carolinensis: First reptile in Ensembl -- Amonida Sadissa<div xmlns='http://www.w3.org/1999/xhtml'><ul><li>Very few anolis proteins and cDNAs, many more ESTs.</li><li>Used Uniprot PE Evidence ranking to generate transcript models with genewise</li><li>Different parameters for Exonerate, including exhaustive option for cDNAs, including 31000 chicken set (which wasn't very useful in the end)</li><li>Chris Ponting group provided extra models and kill list to rename some retrotransposons and pseudogenes</li><li>Manually looked at some of the EST genes in Chris' list to reincorporate them in the main db</li></ul>Word of advise to all Genome Sequencing Centers out there: now that RNAseq is cheap and powerful, please allocate some of your budget for that instead of spending all in genomic sequencing. Contact Sanger people for PCR-free sample preparation protocols, which makes a huge difference in terms of avoiding duplicity.<br/><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=be3b035c-0533-8d87-a34a-f6a0b12e3d44' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-69701969567955033312009-05-07T10:58:00.001+01:002009-05-07T10:58:08.052+01:00FC Barcelona 1991 and 2009 -- find the similarities<div xmlns='http://www.w3.org/1999/xhtml'><a target='_blank' href='http://www.youtube.com/watch?v=6OHYAMG5RTk'>http://www.youtube.com/watch?<wbr/>v=6OHYAMG5RTk</a> (jump to 1:00)<br/><a target='_blank' href='http://www.youtube.com/watch?v=1-4NpWO4ObU'>http://www.youtube.com/watch?<wbr/>v=1-4NpWO4ObU</a><br/><br/><img src='http://lh5.ggpht.com/_VMsVwHYr1_M/SgKwcCGC-fI/AAAAAAAABF4/KwugKwfbrC4/%5BUNSET%5D.jpg?imgmax=800' style='max-width: 800px;'/><br/><img src='http://lh6.ggpht.com/_VMsVwHYr1_M/SgKwgTpS_lI/AAAAAAAABF8/QQfOWWynb78/%5BUNSET%5D.jpg?imgmax=800' style='max-width: 800px;'/><br/><br/>The guy who jumps to celebrate with the wet coat was a very young Guardiola as a player, yesterday he jumped to celebrate at the same spot as a coach... now in a suit and with much less hair...<br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=40366a18-6931-885c-80a1-2653b2facb69' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-37592314158955981662009-05-05T14:46:00.001+01:002009-05-05T14:46:59.441+01:00Drug combinations, gene combinations and cancer -- Sven Nelander<div xmlns='http://www.w3.org/1999/xhtml'>First seminar of the Systems Biology series at the EBI. This series<br/>starts with a strong focus on the modeling side of Systems Biology,<br/>but with the idea of extending it to other subfields.<br/><br/><b>Title: Drug combinations, gene combinations and cancer</b><br/><b>Speaker: Dr <a href='http://www.cmr.gu.se/index.php?sid=10003&gid=57&gsid=4'>Sven Nelander</a></b><br/>Affiliation: Goetebourg University<br/>Date & Time: Tuesday 5th May 2009; 14.00-15.00<br/>Location: C202-3, Shared facilities<br/>Host: <a href='http://www.ebi.ac.uk/Information/Staff/person_maintx.php?s_person_id=1009'>Mikhail Spivakov</a><br/><br/>There is no rational combination theory for different anticancer drugs<br/>so far. One anticancer drug for one step in the pathway, but no<br/>interrelations described.<br/><br/>Increasing number of genotype to phenotype pairs of data sets: what is<br/>the system in the middle?<br/><br/>TCGA with 200 ovarian tumors, first data released last week. Amazing<br/>data production and integrative bioinformatics, but space for more<br/>modeling.<br/><br/>Example: CoPIA<br/><br/>CNV profiles -- transcriptional network -- final mRNA profiles<br/><br/>Now we have 10 million datapoints that with a fully automated<br/>procedure give a testable hypotheses: 3 of the hub (pleiotropic) genes<br/>are not previously implicated in glioma. GO enrichment analysis makes<br/>sense.<br/><br/>PhD student - Theresia Dahl<br/>Peter Gennemark -- mathematical models<br/>Ulrike Nuber<br/>Chris Sander -- old boss<br/>Linda Karlsson-Lindahl<br/>Debora Marks<br/>Niki Schultz<br/>Bodil Nordlander -- now testing one of the new hub genes<br/><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=1dc276fe-0c12-8652-8dbd-6e5f98357a93' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-17068936366332382172009-05-01T16:46:00.001+01:002009-05-01T16:46:00.422+01:00NCBI SRA blastn service<div xmlns='http://www.w3.org/1999/xhtml'>Never easier before to check your sequence against the NCBI Short Read Archive database:<br/><br/><a href='http://tinyurl.com/dl7b9a'>NCBI SRA BLAST</a><br/><br/>First thoughts:<br/><ul><li>Transcriptome coverage is <b>hugely </b>biased to the 3' end (or 5' depending on library preparation). A lot more than I suspected.</li><li>Would be great to do queries for phylogenetic subclades: e.g. my human sequence against all SRA data for primates.</li><li>A lot of the 454 data has homopolymer issues, mostly TTT[...]TTTs but also some others:<br/></li></ul><pre>Query 465 GGGCCTTGACAAAGTGTAAACCGCATGGATGGGCTTCCCC-AAGGATTTATTGACATTGC 523<br /><font color="#ff0000"><b>Sbjct</b></font> 249 ........................................<font color="#ff0000"><b>C</b></font>................... 190<br /><br /></pre><ul><li>Some of these (unless they are real variations) get picked up as mismatches, some as indels:<pre>Query 1 CGGCAAGGTATGTGCGTGATTTTGGGCCCACGTGTATTTCCATTAATTTT-AAGCCGTAA 59<br /><font color="#ff0000"><b>Sbjct</b></font> 224 ..................................................<font color="#ff0000"><b>T</b></font>......... 165<br /><br />Query 60 TTGTCGTTTTTGGCGGTTTCGAGTTGAACTGCGTTAGTCCGTGCGCTGTTCGCAAGTGTG 119<br /><font color="#ff0000"><b>Sbjct</b></font> 164 ..........<font color="#ff0000"><b>C</b></font>................................................. 105<br /></pre></li></ul><pre><br />Query 61 TGTCGTTTTTGGCGGTTTCGAGTTGAACTGCGTTAGTCCGTGCGCTGTTCGCAAGTGTGC 120<br /><font color="#ff0000"><b>Sbjct</b></font> 118 .....<font color="#ff0000"><b>C</b></font>...................................................... 177<br />Query 61 TGTCG-TTTTTGGCGGTTTCGAGTTGAACTGCGTTAGTCCGTGCGCTGTTCGCAAGTGTG 119<br /><font color="#ff0000"><b>Sbjct</b></font> 160 .....<font color="#ff0000"><b>T</b></font>...............................<font color="#ff0000"><b>-</b></font>...................... 102<br />Query 61 TTAATTTTAAGCCGTAATTGTCGTTTTTGGCGGTTTCGAGTTGAACTGCGTTAGTCCGTG 120<br /><font color="#ff0000"><b>Sbjct</b></font> 181 ...........................<font color="#ff0000"><b>C</b></font>................................ 122<br /><br /><br /><br /></pre><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=a5979d81-2e58-8730-b02b-ddbafb1543c7' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-80402805817307916112009-05-01T14:43:00.001+01:002009-05-01T14:43:38.664+01:00A customized and versatile high-density genotyping array for the mouse -- Gary Churchill, The Jackson Laboratory, USA<div xmlns='http://www.w3.org/1999/xhtml'>Microarray based genotyping is an inexpensive and powerful tool to characterize genetic variation. High-density genotyping microarrays are commercially available for humans, economically important livestock and model organisms. However, they have not been available previously for the laboratory mouse, the premier mammalian model organism for biomedical research. Here we describe a custom high-density mouse genotyping array. The Mouse Diversity array was designed to capture the known genetic variation present in the laboratory mouse. It contains 623,124 SNPs distributed across the 19 mouse autosomes, the sex chromosomes, and the mitochondria with a median spacing of one SNP every 1,411 bp in the nuclear genome. The array also contains 916,269 invariant probes that are targeted to functional elements and regions of the genome known to harbor segmental duplications. The nature of the probes opens the door to a variety of novel applications including the characterization of copy number variation, allele specific gene expression and DNA methylation. Performance of the array based on call rate, replication and concordance with previously known genotypes is exceptional. The content-rich Mouse Diversity array provides a critical new tool for mouse genetics including the possibility of extending the successes of genome-wide association studies in humans to the mouse.<br/><br/>Funny comment -- This may be the last chip we do. The economics tell us the line is still below for chips, but sequencing is getting cheaper.<br/><br/>History: people catching mice, trading them, etc. Bottlenecks and all sort of artificial effects.<br/><br/>Diversity 11 classical inbred strains: some chromosomal regions with extremely low diversity. Is this petness? Longevity/Fecundity?<br/><br/>Problem with ascertainment bias: 623124 phylogenetically informative SNPs with known ascertainment<br/><br/><a href='http://mouse.ornl.gov/projects/collabcross.html'>Collaborative Cross</a> -- 8 <i>M. musculus</i> lines -- each contributing equally to the final "line". All inbred by now.<br/><br/>Phenotypes of intermediate CCs: e.g. voluntary exercise goes from 0 miles per day to 18 miles per day.<br/><br/>With 2 different inbred parents, we get complex children but with theoretically predictable phenotype, which means doing GWAS with phenotypes "a la carte".<br/><br/>Also, just by mixing genomes, creating diversity that was not in the parents: very useful novel phenotypic diversity.<br/><br/>Resolution is 7x better. CC will not be GWAS-level, but on the order of 10 genes or MB level resolution. Possibly gene level resolution in 10 generations. Always a mapping resolution panel and a validation panel, going back to the inbred lines.<br/><br/>Selection strictly by random number. Maintaining the diversity is good, lucky because natural selection already took a toll on the original strains.<br/><br/>Done in a way to maximise diversity, not to mimic human population structure. Deep reservoir of diversity for studying phenotypes.<br/><br/>A-Male/B-female crosses and compare to A-Female/B-Male in terms of sex-related epigenetics and other studies.<br/><br/>Some strains will die out along the way, but in 5-10 years should get a lot of info out of it.<br/><br/>Hyuna Yang a lot of array work.<br/>David Aylor pop.struct.<br/><br/>Published mouse distances:<br/><br/>Mus cervicolor - Mus crociduroides = 7.60 MYA<br/>Mus cervicolor - Mus haussa = 6.60 MYA<br/>Mus cervicolor - Mus indutus = 6.60 MYA<br/>Mus cervicolor - Mus mattheyi = 6.60 MYA<br/>Mus cervicolor - Mus minutoides = 6.60 MYA<br/>Mus cervicolor - Mus musculoides = 6.60 MYA<br/>Mus cervicolor - Mus musculus = 4.80 MYA<br/>Mus cervicolor - Mus pahari = 7.60 MYA<br/>Mus cervicolor - Mus platythrix = 7.10 MYA<br/>Mus cervicolor - Mus setulosus = 6.60 MYA<br/>Mus cervicolor - Mus spretus = 4.80 MYA<br/>Mus crociduroides - Mus haussa = 7.60 MYA<br/>Mus crociduroides - Mus indutus = 7.60 MYA<br/>Mus crociduroides - Mus mattheyi = 7.60 MYA<br/>Mus crociduroides - Mus minutoides = 7.60 MYA<br/>Mus crociduroides - Mus musculoides = 7.60 MYA<br/>Mus crociduroides - Mus musculus = 7.60 MYA<br/>Mus crociduroides - Mus pahari = 3.40 MYA<br/>Mus crociduroides - Mus platythrix = 7.60 MYA<br/>Mus crociduroides - Mus setulosus = 7.60 MYA<br/>Mus crociduroides - Mus spretus = 7.60 MYA<br/>Mus haussa - Mus indutus = 3.20 MYA<br/>Mus haussa - Mus mattheyi = 2.60 MYA<br/>Mus haussa - Mus minutoides = 3.20 MYA<br/>Mus haussa - Mus musculoides = 3.20 MYA<br/>Mus haussa - Mus musculus = 6.60 MYA<br/>Mus haussa - Mus pahari = 7.60 MYA<br/>Mus haussa - Mus platythrix = 7.10 MYA<br/>Mus haussa - Mus setulosus = 4.00 MYA<br/>Mus haussa - Mus spretus = 6.60 MYA<br/>Mus indutus - Mus mattheyi = 3.20 MYA<br/>Mus indutus - Mus minutoides = 2.50 MYA<br/>Mus indutus - Mus musculoides = 2.50 MYA<br/>Mus indutus - Mus musculus = 6.60 MYA<br/>Mus indutus - Mus pahari = 7.60 MYA<br/>Mus indutus - Mus platythrix = 7.10 MYA<br/>Mus indutus - Mus setulosus = 4.00 MYA<br/>Mus indutus - Mus spretus = 6.60 MYA<br/>Mus mattheyi - Mus minutoides = 3.20 MYA<br/>Mus mattheyi - Mus musculoides = 3.20 MYA<br/>Mus mattheyi - Mus musculus = 6.60 MYA<br/>Mus mattheyi - Mus pahari = 7.60 MYA<br/>Mus mattheyi - Mus platythrix = 7.10 MYA<br/>Mus mattheyi - Mus setulosus = 4.00 MYA<br/>Mus mattheyi - Mus spretus = 6.60 MYA<br/>Mus minutoides - Mus musculoides = 1.60 MYA<br/>Mus minutoides - Mus musculus = 6.60 MYA<br/>Mus minutoides - Mus pahari = 7.60 MYA<br/>Mus minutoides - Mus platythrix = 7.10 MYA<br/>Mus minutoides - Mus setulosus = 4.00 MYA<br/>Mus minutoides - Mus spretus = 6.60 MYA<br/>Mus musculoides - Mus musculus = 6.60 MYA<br/>Mus musculoides - Mus pahari = 7.60 MYA<br/>Mus musculoides - Mus platythrix = 7.10 MYA<br/>Mus musculoides - Mus setulosus = 4.00 MYA<br/>Mus musculoides - Mus spretus = 6.60 MYA<br/>Mus musculus - Mus pahari = 7.60 MYA<br/>Mus musculus - Mus platythrix = 7.10 MYA<br/>Mus musculus - Mus setulosus = 6.60 MYA<br/>Mus musculus - Mus spretus = 2.30 MYA<br/>Mus pahari - Mus platythrix = 7.60 MYA<br/>Mus pahari - Mus setulosus = 7.60 MYA<br/>Mus pahari - Mus spretus = 7.60 MYA<br/>Mus platythrix - Mus setulosus = 7.10 MYA<br/>Mus platythrix - Mus spretus = 7.10 MYA<br/>Mus setulosus - Mus spretus = 6.60 MYA<br/><br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=79527c79-14f7-8eb6-8300-2e7b1f646eb9' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0tag:blogger.com,1999:blog-8224226.post-37950612926638266562009-04-30T10:39:00.001+01:002009-04-30T10:39:16.411+01:00RNAseq in the worm -- Gary Williams<div xmlns='http://www.w3.org/1999/xhtml'>Illumina Short-read transcriptome data has the potential to help solve many problems with curating gene models and the genomic sequence in <i>C. elegans</i>. This is an initial look at the data and some examples of how it can be used.<br/><br/>So far, <i>C. elegans</i> gene predictions:<br/><br/>36% - fully confirmed by ESTs<br/>48% - partially confirmed<br/>14% - no transcript confirmation<br/><br/>RNAseq data -- different worms than the genome, so some polymorphisms expected -- 200bp inserts, 36bp paired end reads<br/><br/>MAQ or cross-match to genomic or transcript sequences<br/><br/>6137 new splice junctions (6% increase)<br/><br/>Jumped from 70000 to 98000 splice junctions.<br/>3x as many polyA sites<br/>80 possible new coding genes<br/><br/>V-shaped coverages -- validation against traces, then:<br/><ul><li>Detected sequencing error, correction needed for the reference</li><li>Detected alternative haplotype<br/></li></ul>Moving towards single-cell sequencing -- not sequencing in tiny cells but sequencing each cell in each developmental state in the worm. Moving towards RNA sequencing <i>C. briggsae</i> and <i>C. remanei</i>.<br/><br/>Updated gene builds will be given to other projects. Next <a href='http://metazoa.ensembl.org/index.html'>Ensembl Metazoa</a> comparative genomics build may already have the modENCODE-updated <i>C. elegans</i> and <i>D. melanogaster</i> builds.<br/><br/><div class='zemanta-pixie'><img src='http://img.zemanta.com/pixy.gif?x-id=a0edd699-962f-8a58-9808-9285e5b76f7f' class='zemanta-pixie-img'/></div></div>Unknownnoreply@blogger.com0